Short- and Long-Term Regulation of Adenylyl Cyclase Activity by -Opioid Receptor Are Mediated by G i2 in Neuroblastoma N2A Cells

Activation of the opioid receptor results in short-term inhibition of intracellular cAMP levels followed by receptor desensitization and subsequent increase of cAMP above the control level (adenylyl cyclase superactivation). Using adenovirus to deliver pertussis toxin-insensitive mutants of the -subunits of Gi/o that are expressed in neuroblastoma Neuro2A cells (G i2, G i3, and G o), we examined the identities of the G proteins involved in the shortand long-term action of the -opioid receptor (DOR). Pertussis toxin pretreatment completely abolished the ability of [D-Pen,D-Pen]-enkephalin (DPDPE) to inhibit forskolin-stimulated intracellular cAMP production. Expression of the C352L mutant of G i2, and not the C351L mutants of G i3 or G o, rescued the short-term effect of DPDPE after pertussis toxin treatment. The ability of G i2 in mediating DOR inhibition of adenylyl cyclase activity was also reflected in the ability of G i2, not G i3 or G o, to coimmunoprecipitate with DOR. Coincidently, after long-term DPDPE treatment, pertussis toxin treatment eliminated the antagonist naloxone-induced superactivation of adenylyl cyclase activity. Again, only the C352L mutant of G i2 restored the adenylyl cyclase superactivation after pertussis toxin treatment. More importantly, the C352L mutant of G i2 remained associated with DOR after long-term agonist and pertussis toxin treatment whereas the wild-type G i2 did not. These data suggest that G i2 serves as the signaling molecule in both DOR-mediated shortand long-term regulation of adenylyl cyclase activity. Opioid receptors belong to the family of seven transmembrane domain receptors that transduce their signals via Gi/o proteins (Law and Loh, 1999; Law et al., 2000). Short-term activation of opioid receptors results in myriad responses, including inhibition of adenylyl cyclase (AC), inhibition of voltage-gated Ca channels, and activation of G-protein activated inwardly rectifying K channels, leading to reduced excitability and inhibition of neurotransmitter release (Childers, 1991; Breivogel et al., 1997; Varga et al., 2003). However, long-term drug treatment results in tolerance and dependence development, the molecular mechanism of which may involve desensitization to Gi/o protein-mediated responses, coupled with sensitization to excitatory opioid actions. One such excitatory action is the compensatory increase in intracellular cAMP accumulation after long-term agonist treatment, or AC superactivation, which is particularly significant upon the withdrawal of opioid agonist. This AC superactivation phenomenon has been postulated to be responsible for the development of drug tolerance and dependence (Koob and Bloom, 1988; Nestler and Aghajanian, 1997; Charles and Hales, 2004). The heterotrimeric G proteins serve as central signaling molecules connecting cellular signals transduced from opioid receptors. Involvement of Gi/o protein subunits (G i1, G i2, G i3, and G o) in AC superactivation is clearly indicated by the ability of pertussis toxin (PTX) to block this response (Avidor-Reiss et al., 1995; Fields and Casey, 1997; Connor and Christie, 1999; Nevo et al., 2000). However, the specific G subunit(s) responsible and by what means it regulates AC superactivation are still unresolved. Tso and Wong (2000a,b, 2001) reported that in HEK293 cells stably expressing -opioid receptors (MOR), AC superactivation induced by longterm -agonist treatment cannot be supported by either G z (Tso and Wong, 2000b), G i2 (Tso and Wong, 2000a), G i1, or G i3 (Tso and Wong, 2001) individually. On the other hand, This research was supported in part by National Institutes of Health grants DA007339, DA016674, DA000564, DA001583, DA011806, K05-DA70544 (to H.H.L.), and K05-DA00513 (P.-Y.L.). Article, publication date, and citation information can be found at http://molpharm.aspetjournals.org. doi:10.1124/mol.105.021352. ABBREVIATIONS: AC, adenylyl cyclase; PTX, pertussis toxin; HEK, human embryonic kidney; MOR, -opioid receptor; DOR, -opioid receptor; N2A, Neuro2A; PCR, polymerase chain reaction; RT, reverse transcription; DMEM, Dulbecco’s modified Eagle’s medium; DPDPE, [D-Pen ,DPen]-enkephalin; MAPK, mitogen-activated protein kinase; ERK, extracellular-signal regulated kinase; RGS, regulator of G protein signaling; GFP, green fluorescent protein; HA, hemagglutinin; N2A, neuroblastoma Neuro2A cells. 0026-895X/06/6906-1810–1819$20.00 MOLECULAR PHARMACOLOGY Vol. 69, No. 6 Copyright © 2006 The American Society for Pharmacology and Experimental Therapeutics 21352/3115464 Mol Pharmacol 69:1810–1819, 2006 Printed in U.S.A. 1810 at A PE T Jornals on Sptem er 1, 2017 m oharm .aspeurnals.org D ow nladed from G o has been suggested to be responsible for MOR-induced AC superactivation in C6 glioma cells (Clark et al., 2004). However, in these studies, systems were pretreated with PTX before long-term agonist exposure. The blunting of the long-term response could be the result of the absence of initial receptor signals being transduced. To address these questions on the identity of G proteins involved in both short-term inhibition and superactivation of AC activity, we use adenovirus to deliver the individual PTXinsensitive Gi/o -subunit mutant to neuroblastoma Neuro2A cells (N2A) stably expressing -opioid receptor (DOR). It can be demonstrated that only the G i2 and not G i3 or G o mutant could rescue the DPDPE induced inhibition of adenylyl cyclase activity after PTX pretreatment. Coincidentally, after long-term DPDPE treatment, only the G i2 mutant could restore AC superactivation after PTX treatment. More importantly, only G i2 and not G i3 or G o coimmunoprecipated with DOR. Therefore, the same G i2 mediates both short-term inhibition and long-term superactivation of adenylyl cyclase activity. Materials and Methods Mutagenesis of PTX-Resistant G i/o. Point mutations were accomplished using QuikChange site-directed mutagenesis methods as outlined by Stratagene (La Jolla, CA). Previous studies indicated that substitution of the cysteine (Cys) residue within the CAXX motif of the Gi/o -subunit with leucine (Leu) resulted in full efficacy of the mutant to transduce receptor signal (Bahia et al., 1998). Hence, the Cys of G i3 and G o or Cys 352 of G i2 was mutated to Leu. Point mutation primers were designed as follows: for G i2, 5 -GAACAACCTGAAGGACCTAGGCCTCTTCTGAGGG-3 ; for G i3, 5 -CAACTTAAAGGAGCTCGGGCTTTACTGAGAG-3 ; and for G o, 5 -CAACAATCTCCGGGGCCTAGGCTTGTACTGACC-3 . Adenovirus Construction. G i2, G i3, or G o mutant was cloned into pShuttle-CMV vector (Stratagene) following the manufacturer’s protocol. In brief, the recombinant plasmids were cotransformed with pAdEasy-1 into BJ 5183 cells by electroporation. The positive adeno-G i2-Leu, adeno-G i3-Leu, or adeno-G o-Leu plasmid was transfected into HEK293 cells. The virus was harvested and amplified by repeatedly infecting HEK293 cells. The titer of virus was determined using the Adeno-X Rapid Titer Kit (Clontech, Mountain View, CA). The viruses used in current studies have titers from 3.0 to 8.0 10 plaque-forming units/ml. RT-PCR. Total RNA of N2A cells was isolated using Tri Reagent (Molecular Research Center, Cincinnati, OH) according to the manufacturer’s instructions. RNA samples were then treated with DNase I (Ambion, Austin, TX). Reverse transcription reaction (RT) was performed using First Strand cDNA Synthesis Kit (Roche Applied Science, Indianapolis, IN) according to the manufacturer’s recommendations and 0.5 g of DNase I-treated total RNA was added to each RT reaction. For each PCR reaction, 2 l of RT reaction solution and 2 units of Taq DNA Polymerase (Roche Applied Science) was added to a final 50l scale. The PCR conditions were as follows: 2 min at 94°C and then 15 s at 94°C, 30 s at 60°C (53°C for G i1 and G oA), 30 s at 72°C for 25 cycles (35 cycles for G i1 and G oA), and 10 min at 72°C. The PCR primers for each specific G subunit were designed as follows: G i1: forward, ATGAACCGAATGCATGAGAGCA; reverse, GTCCTT CCTTTTATTGAGGTCT; G i2: forward, GCCAACAAGTACGACGAGGCA; reverse, GTATCTCTCACGCTTCTTGTGCT; G i3: forward, ATGAACCGAATGCATGAGAGCA; reverse, TTTGGTGTCAGTG GCACAGGTA; G oA: forward, CCCGTAGATTTTTGGCGATGA; reverse, CCGCATGCACGAGTCTCTCAT; G oB: forward, CCCGTAGGT TTTTGGCGATGA; reverse, CATGCACGAATCCCTGAAGC. Cell Culture and Virus Infection. N2A cells stably expressing mouse DOR with hemagglutinin (HA) tagged at the N terminus were used in this study. Cells were cultured at 37°C in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum, 15 mM glucose, 0.43 M NaHCO3, 100 units/ml penicillin, 100 g/ml streptomycin (Invitrogen, Carlsbad, CA) and 1 mg/ml G418 (Geneticin; Invitrogen) in a 10% CO2 incubator. Each T-75 cm 2 flask of cells at 70% confluence was infected with adeno-GFP (Gene Transfer Vector Core, The University of Iowa), adeno-G i2-Leu, adenoG i3-Leu, or adeno-G o-Leu viruses using Superfect transfection reagent (QIAGEN) according to the manufacturer’s instructions, with a cell-to-virus ratio of 1:100. After 48 h, cells were harvested for Western blotting and immunoprecipitation experiments. For the DOR-mediated regulation of intracellular cAMP level, cells were seeded to 96-well plates 30 h after virus infection and cultured for another 18 h before cAMP assay. cAMP Assay. For short-term DPDPE inhibition assay, cells were seeded on a 96-well plate for 18 h, culture medium was removed, and the cells were placed on ice. Then, 100 l of incubation buffer with or without DPDPE was added to each well. The incubation buffer consisted of 0.5 mM 3-isobutyl-1-methylxanthine and 10 M forskolin in Krebs-Ringer-HEPES buffer (110 mM NaCl, 25 mM glucose, 55 mM sucrose, 10 mM HEPES, 5 mM KCl, 1 mM MgCl2, and 1.8 mM CaCl2, pH 7.4). The assays were initiated by incubating the cells at 37°C for 15 min and then terminated by placing the plates in a water bath at 85°C for 6 min to lyse the cells and release the intracellular cAMP. The cAMP level was measured by using the AlphaScreen cAMP Detection Kit (BioSignal, Montreal, QC, Canada) and Biomek 2000 Laboratory Automation Workstation (Beckman Coulter, Fullerton, CA) as described previously (Qiu et al., 2003). For the experiments in which pertussis toxin (List Biological Laboratories Inc., Campbell, CA) was used, 100 ng/ml PTX was added to the culture medium, and cells were incubated 12 h before the cAMP assay. For long-term DPDPE treatment assay, 1 M DPDPE was added to the culture medium for 18 h to completely desensitize the short-term response to DOR activation. Six hours before cAMP assays, or 12 h after the initiation of DPDPE treatment, PTX was added to the designated 96-well plates. Culture medium was aspirated, cells were washed with DMEM at 37°C once, and then 100 l of treatment buffer with or without naloxone was added. After incubation at 37°C for 15 min, reactions were terminated by incubating at 85°C for 6 min and cAMP level in each well was measured as described previ-